ID: 1081878827_1081878833

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1081878827 1081878833
Species Human (GRCh38) Human (GRCh38)
Location 11:46430308-46430330 11:46430351-46430373
Sequence CCATGCACAAAACCACAATGGCA TGCCTTGCTGAGGAGGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 193} {0: 1, 1: 1, 2: 3, 3: 38, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!