ID: 1081906341_1081906346

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1081906341 1081906346
Species Human (GRCh38) Human (GRCh38)
Location 11:46672734-46672756 11:46672758-46672780
Sequence CCAGCTGGTGGCCAAGAGATTGG GTGGAGTCGCAGAAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 153} {0: 1, 1: 0, 2: 1, 3: 33, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!