ID: 1081914876_1081914883

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1081914876 1081914883
Species Human (GRCh38) Human (GRCh38)
Location 11:46724274-46724296 11:46724327-46724349
Sequence CCATGAGGGTTGGCAGGTGTGGC TGACGGAGGTTGGCCCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 179} {0: 1, 1: 0, 2: 0, 3: 17, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!