ID: 1081915637_1081915644

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1081915637 1081915644
Species Human (GRCh38) Human (GRCh38)
Location 11:46728515-46728537 11:46728547-46728569
Sequence CCAGGGGGCTGCCATGGCAGGAA TCCCCTCCCTGGTGGCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 271} {0: 1, 1: 0, 2: 6, 3: 45, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!