ID: 1081915638_1081915644

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1081915638 1081915644
Species Human (GRCh38) Human (GRCh38)
Location 11:46728526-46728548 11:46728547-46728569
Sequence CCATGGCAGGAACCAGCCCTATC TCCCCTCCCTGGTGGCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 251} {0: 1, 1: 0, 2: 6, 3: 45, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!