ID: 1081960558_1081960569

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1081960558 1081960569
Species Human (GRCh38) Human (GRCh38)
Location 11:47133519-47133541 11:47133549-47133571
Sequence CCAGCACAGTGGTCCCCCAGCCC CTGGCCTGAGGCTGCTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 382} {0: 1, 1: 0, 2: 8, 3: 68, 4: 512}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!