ID: 1081964510_1081964514

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1081964510 1081964514
Species Human (GRCh38) Human (GRCh38)
Location 11:47161428-47161450 11:47161442-47161464
Sequence CCTCTCGCTGCCCTCCAGGCTTC CCAGGCTTCTTCCCTTCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 408} {0: 1, 1: 0, 2: 3, 3: 34, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!