ID: 1081967885_1081967898

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1081967885 1081967898
Species Human (GRCh38) Human (GRCh38)
Location 11:47180441-47180463 11:47180485-47180507
Sequence CCACCCAGCCTCACCTCCTTCAG GGCCTTGCGGAAGCCGTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 119, 4: 857} {0: 1, 1: 0, 2: 0, 3: 1, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!