ID: 1081993030_1081993045

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1081993030 1081993045
Species Human (GRCh38) Human (GRCh38)
Location 11:47347760-47347782 11:47347803-47347825
Sequence CCCGCAAATCATCCCCAGCCCTG AGGGCCTCAGACTCCAGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 271} {0: 1, 1: 1, 2: 1, 3: 29, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!