ID: 1081995603_1081995608

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1081995603 1081995608
Species Human (GRCh38) Human (GRCh38)
Location 11:47361643-47361665 11:47361685-47361707
Sequence CCAGGCAGTGTCTCTGGGACAAG GCGTGTGTACGTGTGTACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 211} {0: 1, 1: 0, 2: 1, 3: 41, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!