ID: 1082001354_1082001364

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1082001354 1082001364
Species Human (GRCh38) Human (GRCh38)
Location 11:47395162-47395184 11:47395190-47395212
Sequence CCAGGGCCAGGCCTACTTTGGCC TAAATCAGAATGTGGGGTCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 24, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!