ID: 1082003686_1082003700

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1082003686 1082003700
Species Human (GRCh38) Human (GRCh38)
Location 11:47408499-47408521 11:47408537-47408559
Sequence CCTCGGGTTCCGGACAGGCCCCT CGCCGGGGGCGGCCCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81} {0: 1, 1: 0, 2: 9, 3: 92, 4: 745}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!