ID: 1082004988_1082005004

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1082004988 1082005004
Species Human (GRCh38) Human (GRCh38)
Location 11:47414495-47414517 11:47414532-47414554
Sequence CCCCCAGGGGCCCAGGCCCCCAC GCATGGGTGTGGAGCTCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 10, 3: 77, 4: 638} {0: 1, 1: 0, 2: 5, 3: 37, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!