ID: 1082005375_1082005380

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1082005375 1082005380
Species Human (GRCh38) Human (GRCh38)
Location 11:47416100-47416122 11:47416115-47416137
Sequence CCCGGTCCAGCTCAGGGATGCTC GGATGCTCCTGCCAGCACAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 209} {0: 1, 1: 0, 2: 2, 3: 26, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!