ID: 1082005823_1082005831

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1082005823 1082005831
Species Human (GRCh38) Human (GRCh38)
Location 11:47418472-47418494 11:47418510-47418532
Sequence CCAAAATGCCGAAAGTGAAAGGG TCCTCTGTGCAGGAACTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 76, 4: 1452} {0: 1, 1: 0, 2: 2, 3: 21, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!