ID: 1082005826_1082005831

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1082005826 1082005831
Species Human (GRCh38) Human (GRCh38)
Location 11:47418480-47418502 11:47418510-47418532
Sequence CCGAAAGTGAAAGGGTGGCTTCT TCCTCTGTGCAGGAACTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 164} {0: 1, 1: 0, 2: 2, 3: 21, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!