ID: 1082006741_1082006750

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1082006741 1082006750
Species Human (GRCh38) Human (GRCh38)
Location 11:47423464-47423486 11:47423497-47423519
Sequence CCAGGAACGGGAGTATATGGCAG GGGCCAGGGGCTGGGAGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61} {0: 1, 1: 1, 2: 30, 3: 381, 4: 2644}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!