ID: 1082013529_1082013534

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1082013529 1082013534
Species Human (GRCh38) Human (GRCh38)
Location 11:47467290-47467312 11:47467307-47467329
Sequence CCAAGACCCTGAGGCTGGATGGT GATGGTGCCACAAGAGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 241} {0: 1, 1: 0, 2: 2, 3: 33, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!