|
Left Crispr |
Right Crispr |
| Crispr ID |
1082054762 |
1082054772 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:47804857-47804879
|
11:47804891-47804913
|
| Sequence |
CCAGGCACGGTGGCTCACTCCTG |
CTTTGGAAGGGTAAGGTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 408, 1: 18105, 2: 82417, 3: 133835, 4: 157680} |
{0: 3, 1: 87, 2: 3746, 3: 56082, 4: 135240} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|