ID: 1082086856_1082086867

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1082086856 1082086867
Species Human (GRCh38) Human (GRCh38)
Location 11:48057535-48057557 11:48057587-48057609
Sequence CCCAGAGGCCTTCTCACGTGGGT GTAGCCCCCATAATACTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 87} {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!