ID: 1082086859_1082086865

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1082086859 1082086865
Species Human (GRCh38) Human (GRCh38)
Location 11:48057543-48057565 11:48057559-48057581
Sequence CCTTCTCACGTGGGTCGAGGCAG GAGGCAGGTGGTGGAGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70} {0: 1, 1: 2, 2: 51, 3: 461, 4: 3450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!