ID: 1082092428_1082092434

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1082092428 1082092434
Species Human (GRCh38) Human (GRCh38)
Location 11:48100966-48100988 11:48100994-48101016
Sequence CCTTTGCTTCAGCTCCCTCCTGT CTCATTGCTGAGAGTGGGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 443} {0: 1, 1: 0, 2: 2, 3: 19, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!