ID: 1082172278_1082172280

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1082172278 1082172280
Species Human (GRCh38) Human (GRCh38)
Location 11:49019806-49019828 11:49019821-49019843
Sequence CCTGTCTCTAAAAACAAAATGTT AAAATGTTTTTACCCAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 107, 3: 912, 4: 5326} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!