ID: 1082301043_1082301047

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1082301043 1082301047
Species Human (GRCh38) Human (GRCh38)
Location 11:50506706-50506728 11:50506747-50506769
Sequence CCATCTAGTTTTTATCCTTGGAT GGCCTCAATGAACTCCCAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 22, 3: 39, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!