ID: 1082519592_1082519599

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1082519592 1082519599
Species Human (GRCh38) Human (GRCh38)
Location 11:53947804-53947826 11:53947850-53947872
Sequence CCAAACACACTTTCTGTAGAATC CTGTGGATTTCGTTGGAAAAGGG
Strand - +
Off-target summary {0: 2662, 1: 1244, 2: 2118, 3: 3267, 4: 477} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!