ID: 1082599517_1082599518

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1082599517 1082599518
Species Human (GRCh38) Human (GRCh38)
Location 11:55132476-55132498 11:55132500-55132522
Sequence CCTATGGTGATAAAGAAAATATC TCACCTATAAACTATAAAGAAGG
Strand - +
Off-target summary {0: 11, 1: 435, 2: 12831, 3: 23576, 4: 28401} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!