ID: 1082644469_1082644473

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1082644469 1082644473
Species Human (GRCh38) Human (GRCh38)
Location 11:55704483-55704505 11:55704527-55704549
Sequence CCATCTATCTTCTGCCTATAAGA AACATATACATTTTAAAATATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 18, 3: 185, 4: 1333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!