ID: 1082652949_1082652952

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1082652949 1082652952
Species Human (GRCh38) Human (GRCh38)
Location 11:55817179-55817201 11:55817197-55817219
Sequence CCTGACTCCTGAACAATAGTCTT GTCTTATGAAAACAGGTACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!