ID: 1082698760_1082698768

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1082698760 1082698768
Species Human (GRCh38) Human (GRCh38)
Location 11:56402145-56402167 11:56402173-56402195
Sequence CCGCAGCCGCTGGCCTGGGTGCT CCTTATTGCCCAGGGCCAGCAGG
Strand - +
Off-target summary {0: 41, 1: 374, 2: 554, 3: 348, 4: 523} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!