ID: 1082698761_1082698769

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1082698761 1082698769
Species Human (GRCh38) Human (GRCh38)
Location 11:56402151-56402173 11:56402174-56402196
Sequence CCGCTGGCCTGGGTGCTAAGCCC CTTATTGCCCAGGGCCAGCAGGG
Strand - +
Off-target summary {0: 54, 1: 275, 2: 367, 3: 198, 4: 260} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!