ID: 1082698766_1082698776 |
View in Genome Browser |
Spacer: 2 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1082698766 | 1082698776 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 11:56402172-56402194 | 11:56402197-56402219 |
Sequence | CCCTTATTGCCCAGGGCCAGCAG | CCAGCCAGCTGCTCCGAGTGGGG |
Strand | - | + |
Off-target summary | No data | {0: 11, 1: 51, 2: 254, 3: 398, 4: 649} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |