ID: 1082698767_1082698776

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1082698767 1082698776
Species Human (GRCh38) Human (GRCh38)
Location 11:56402173-56402195 11:56402197-56402219
Sequence CCTTATTGCCCAGGGCCAGCAGG CCAGCCAGCTGCTCCGAGTGGGG
Strand - +
Off-target summary No data {0: 11, 1: 51, 2: 254, 3: 398, 4: 649}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!