ID: 1082706042_1082706050

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1082706042 1082706050
Species Human (GRCh38) Human (GRCh38)
Location 11:56496541-56496563 11:56496571-56496593
Sequence CCCTCTCCCTCCACGGTCTCCCT TCCCTCTCCCTCTCTCTCCACGG
Strand - +
Off-target summary {0: 44, 1: 95, 2: 678, 3: 688, 4: 908} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!