ID: 1082706049_1082706059

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1082706049 1082706059
Species Human (GRCh38) Human (GRCh38)
Location 11:56496567-56496589 11:56496599-56496621
Sequence CCTCTCCCTCTCCCTCTCTCTCC CTCTGATGCCCAGCCGAGGCTGG
Strand - +
Off-target summary No data {0: 32, 1: 146, 2: 615, 3: 538, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!