ID: 1082718673_1082718681

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1082718673 1082718681
Species Human (GRCh38) Human (GRCh38)
Location 11:56646561-56646583 11:56646583-56646605
Sequence CCATCCTTCTTCTGTCTCCCCTG GGTAGCTGGAGGTTTGTCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!