ID: 1082783318_1082783324

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1082783318 1082783324
Species Human (GRCh38) Human (GRCh38)
Location 11:57302930-57302952 11:57302946-57302968
Sequence CCCTCCTTCCCATGCTTTTTCCA TTTTCCAGACTCCAAGGACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 734} {0: 1, 1: 0, 2: 2, 3: 26, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!