ID: 1082783318_1082783326

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1082783318 1082783326
Species Human (GRCh38) Human (GRCh38)
Location 11:57302930-57302952 11:57302951-57302973
Sequence CCCTCCTTCCCATGCTTTTTCCA CAGACTCCAAGGACACGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 734} {0: 1, 1: 0, 2: 1, 3: 4, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!