ID: 1082785518_1082785525

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1082785518 1082785525
Species Human (GRCh38) Human (GRCh38)
Location 11:57314167-57314189 11:57314196-57314218
Sequence CCACTCAACCCAAAGCTCATGTG TCCTCAGAGGCCACAGTTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 183} {0: 1, 1: 0, 2: 0, 3: 14, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!