ID: 1082794885_1082794907

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1082794885 1082794907
Species Human (GRCh38) Human (GRCh38)
Location 11:57371644-57371666 11:57371689-57371711
Sequence CCCTAACCCACAGCCCCATGCCC CAGGGTCAGCCTTGGGAATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 441} {0: 1, 1: 0, 2: 1, 3: 19, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!