ID: 1082802933_1082802939

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1082802933 1082802939
Species Human (GRCh38) Human (GRCh38)
Location 11:57427425-57427447 11:57427445-57427467
Sequence CCCAGCACCCAGAGGACACACAG CAGACAGCACATGAGGGCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 401} {0: 1, 1: 0, 2: 1, 3: 15, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!