ID: 1082824390_1082824402

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1082824390 1082824402
Species Human (GRCh38) Human (GRCh38)
Location 11:57567476-57567498 11:57567509-57567531
Sequence CCAGACAAATAAATAAATGTGCT CGGAGGGGATGGAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 377} {0: 1, 1: 2, 2: 70, 3: 1058, 4: 8316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!