ID: 1082839810_1082839817

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1082839810 1082839817
Species Human (GRCh38) Human (GRCh38)
Location 11:57679765-57679787 11:57679811-57679833
Sequence CCTTAAATCAAGCAGAATTTGGG CACACATGCCTCTCCTTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 150} {0: 1, 1: 0, 2: 1, 3: 13, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!