|
Left Crispr |
Right Crispr |
| Crispr ID |
1082841376 |
1082841384 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:57692914-57692936
|
11:57692950-57692972
|
| Sequence |
CCTTTTTGGCAGCAGGGACCGGT |
CTTTTTCCACAGATGGGGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 187, 2: 1319, 3: 1501, 4: 1052} |
{0: 1, 1: 8, 2: 34, 3: 143, 4: 565} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|