ID: 1082850717_1082850719

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1082850717 1082850719
Species Human (GRCh38) Human (GRCh38)
Location 11:57761962-57761984 11:57761981-57762003
Sequence CCTGCTGGATTTGTCTTTCTCAG TCAGCACCTTGGCGAAGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 304} {0: 1, 1: 0, 2: 0, 3: 8, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!