ID: 1082855151_1082855158

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1082855151 1082855158
Species Human (GRCh38) Human (GRCh38)
Location 11:57799337-57799359 11:57799384-57799406
Sequence CCAGATGGGTGTGGGTGGCCAGG GCTAGTTCACATAGAGTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 307} {0: 1, 1: 0, 2: 2, 3: 12, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!