ID: 1082855156_1082855159

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1082855156 1082855159
Species Human (GRCh38) Human (GRCh38)
Location 11:57799375-57799397 11:57799389-57799411
Sequence CCTAGTTGTGCTAGTTCACATAG TTCACATAGAGTTTTGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82} {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!