ID: 1082896873_1082896879

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1082896873 1082896879
Species Human (GRCh38) Human (GRCh38)
Location 11:58201137-58201159 11:58201165-58201187
Sequence CCTACTACCATCAGTTTGAGGGT TTTTAACACATGAATTTTGGGGG
Strand - +
Off-target summary No data {0: 6, 1: 140, 2: 778, 3: 2332, 4: 4435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!