ID: 1082897139_1082897144

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1082897139 1082897144
Species Human (GRCh38) Human (GRCh38)
Location 11:58204020-58204042 11:58204043-58204065
Sequence CCCAACCACAGTGACCACATACA TACTCAGGAAAAGCACAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 237} {0: 1, 1: 0, 2: 3, 3: 26, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!