ID: 1082897141_1082897144

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1082897141 1082897144
Species Human (GRCh38) Human (GRCh38)
Location 11:58204025-58204047 11:58204043-58204065
Sequence CCACAGTGACCACATACATACTC TACTCAGGAAAAGCACAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 183} {0: 1, 1: 0, 2: 3, 3: 26, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!