|
Left Crispr |
Right Crispr |
| Crispr ID |
1082935428 |
1082935431 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:58652094-58652116
|
11:58652122-58652144
|
| Sequence |
CCTATAGCATGGTGCTGCTGAGC |
CTCTGATTTGGCATCTCCTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 1, 2: 19, 3: 42, 4: 166} |
{0: 25, 1: 40, 2: 53, 3: 80, 4: 220} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|